catR [2019-09-03 10:22:47]

MarR/DUF24 family transcription repressor of the catD-catE operon

Locus: BSU_33680

Isoelectric point: 9.89

Molecular weight: 26.99 kDa

Protein length: 108 aa

Gene length: 327 bp

Function: resistance against oxidative and electrophile stress

Product: MarR/DUF24 family transcription repressor

Essential: no

Synonyms: yvaP

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress

Gene

Coordinates: 3,457,615 3,457,941

Phenotypes of a mutant

• increased resistance to catechol and quinones PubMed

The protein

Catalyzed reaction/ biological activity

• MarR/DUF24 family transcription repressor of the catD-catE operon PubMed

Protein family

• MarR/DUF24 family

Paralogous protein(s)

• YodB

Modification

• in responsse to the presence of diamides or quinones, Cys-7 forms intermolecular disulfide bonds, this results in loss of DNA-bindig ability (induction of catD-catE) PubMed

Structure

• 5HS7 (YodB, 46% identity) PubMed

Expression and Regulation

Operons

• Genes: catR
  Description: PubMed

Biological materials

Mutant

• MGNA-A451 (yvaP::erm), available at the NBRP B. subtilis, Japan
• BKE33680 (catR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACTTTTCACCTCGTCTG, downstream forward: _UP4_TAATTGCTAAAATGGTTCTG
• BKK33680 (catR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACTTTTCACCTCGTCTG, downstream forward: _UP4_TAATTGCTAAAATGGTTCTG

Labs working on this gene/protein

• Haike Antelmann,University of Greifswald, Germany

References

Loading